Review



cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models
    Cell Lines Hek293t Cells Atcc Crl3216 H Vegf Reporter 293 Cell Line Genomeditech Gm C09057 Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 37978 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42285094-518-7-11
    Average 99 stars, based on 37978 article reviews
    cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Structural characterization of Thogoto Virus nucleoprotein provides insights into viral RNA encapsidation and RNP assembly.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Flag-tag Sigma MAB3118; RRID: AB_9470 Anti-HA-tag Sigma H3663; RRID: AB_262051 Anti-b-actin Sigma A2228; RRID: AB_476697 Anti-Flag-M2 affinity gel Sigma A2220; RRID: AB_10063035 Anti-THOV NP Ab Kochs et al.67 N/A Bacterial and virus strains E. coli BL21 (DE3) Rosetta strain Novagen/Sigma #70954 THOV, strain SiAr126 Albanese et al.64 N/A Chemicals, peptides, and recombinant proteins GST-tagged PreScission Protease This Paper N/A Seleno-L-methionine Sigma # S3132 Isopropyl-b-D-thiogalactopyranoside (IPTG) Sigma 10724815001 NP-40 alternative CalBioChem 492016 Triton X-100 Sigma 93426 Lysolecithin Sigma L5254 Deposited data THOV NP (delta 188-196) Apo Structure This Paper PDB: 8CJW THOV RNP This Paper PDB: 8RYT,EMDB: EMD-19599 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides single-stranded RNA of varying length (pU14 - pU24) This Paper https://www.idtdna.com/pages/products/ custom-dna-rna/custom-rna-oligos Primer used in this study (Table S5) This Paper N/A Recombinant DNA pET28 plasmids (THOV NP constructs) This Paper N/A pCAGGS Niwa et al.65 N/A pHH21-vNP-FFLuc Patzina et al.66 N/A pRL-SV40 Promega E2231 Software and algorithms Sedfit Schuck et al.46 https://sedfitsedphat.github.io/ SEDNTERP Laue et al.47 http://www.jphilo.mailway.com/sednterp.htm Omnisec No reference available https://www.malvernpanalytical.com/en/products/ product-range/omnisec SHELXD Sheldrick et al.48 https://www.ccp4.ac.uk/download/shelx.php HKL2MAP Pape et al.49 https://www.ccp4.ac.uk/schools/APS-2010/tutorials/ shelx/tutorial_shelx_chicago2008.pdf Coot Emsley et al.50 https://www.ccp4.ac.uk/download/#os=windows Phaser McCoy et al.51 https://www.ccp4.ac.uk/html/phaser.html Phenix Afonine et al.52 https://phenix-online.org/ PyMOL Molecular Graphics System, Version 2.5.2 Schrödinger https://pymol.org/ Consurf Server Ashkenazy et al.53 https://consurf.tau.ac.il/consurf_index.php Chimera Pettersen et al.54 https://www.cgl.ucsf.edu/chimera/ (Continued on next page) Structure 32, 1068–1078.e1–e5, August 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Relion 4 Kimanius et al.62 Zivanov et al.63 https://relion.readthedocs.io/en/release-4.0/ IMOD Mastronarde et al.55 https://bio3d.colorado.edu/imod/ Dynamo Castaño-Dı́ez et al.61 https://www.dynamo-em.org//w/ index.php?title=Main_Page Origin Pro https://www.originlab.com/ https://www.originlab.com/ GraphPad Prism 6 Dotmatics https://www.graphpad.com/support/updates/ ?program=Prism&platform=Win&version=6.04 TomoBEAR Balyschew et al.57 https://github.com/KudryashevLab/TomoBEAR GCTF Zhang et al.60 https://www2.mrc-lmb.cam.ac.uk/download/gctf/ MotionCor2 Zheng et al.58 https://emcore.ucsf.edu/ucsf-software AreTomo Zheng et al.59 https://msg.ucsf.edu/software

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    Recombinant:

    Article Title: Structural characterization of Thogoto Virus nucleoprotein provides insights into viral RNA encapsidation and RNP assembly.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Flag-tag Sigma MAB3118; RRID: AB_9470 Anti-HA-tag Sigma H3663; RRID: AB_262051 Anti-b-actin Sigma A2228; RRID: AB_476697 Anti-Flag-M2 affinity gel Sigma A2220; RRID: AB_10063035 Anti-THOV NP Ab Kochs et al.67 N/A Bacterial and virus strains E. coli BL21 (DE3) Rosetta strain Novagen/Sigma #70954 THOV, strain SiAr126 Albanese et al.64 N/A Chemicals, peptides, and recombinant proteins GST-tagged PreScission Protease This Paper N/A Seleno-L-methionine Sigma # S3132 Isopropyl-b-D-thiogalactopyranoside (IPTG) Sigma 10724815001 NP-40 alternative CalBioChem 492016 Triton X-100 Sigma 93426 Lysolecithin Sigma L5254 Deposited data THOV NP (delta 188-196) Apo Structure This Paper PDB: 8CJW THOV RNP This Paper PDB: 8RYT,EMDB: EMD-19599 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides single-stranded RNA of varying length (pU14 - pU24) This Paper https://www.idtdna.com/pages/products/ custom-dna-rna/custom-rna-oligos Primer used in this study (Table S5) This Paper N/A Recombinant DNA pET28 plasmids (THOV NP constructs) This Paper N/A pCAGGS Niwa et al.65 N/A pHH21-vNP-FFLuc Patzina et al.66 N/A pRL-SV40 Promega E2231 Software and algorithms Sedfit Schuck et al.46 https://sedfitsedphat.github.io/ SEDNTERP Laue et al.47 http://www.jphilo.mailway.com/sednterp.htm Omnisec No reference available https://www.malvernpanalytical.com/en/products/ product-range/omnisec SHELXD Sheldrick et al.48 https://www.ccp4.ac.uk/download/shelx.php HKL2MAP Pape et al.49 https://www.ccp4.ac.uk/schools/APS-2010/tutorials/ shelx/tutorial_shelx_chicago2008.pdf Coot Emsley et al.50 https://www.ccp4.ac.uk/download/#os=windows Phaser McCoy et al.51 https://www.ccp4.ac.uk/html/phaser.html Phenix Afonine et al.52 https://phenix-online.org/ PyMOL Molecular Graphics System, Version 2.5.2 Schrödinger https://pymol.org/ Consurf Server Ashkenazy et al.53 https://consurf.tau.ac.il/consurf_index.php Chimera Pettersen et al.54 https://www.cgl.ucsf.edu/chimera/ (Continued on next page) Structure 32, 1068–1078.e1–e5, August 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Relion 4 Kimanius et al.62 Zivanov et al.63 https://relion.readthedocs.io/en/release-4.0/ IMOD Mastronarde et al.55 https://bio3d.colorado.edu/imod/ Dynamo Castaño-Dı́ez et al.61 https://www.dynamo-em.org//w/ index.php?title=Main_Page Origin Pro https://www.originlab.com/ https://www.originlab.com/ GraphPad Prism 6 Dotmatics https://www.graphpad.com/support/updates/ ?program=Prism&platform=Win&version=6.04 TomoBEAR Balyschew et al.57 https://github.com/KudryashevLab/TomoBEAR GCTF Zhang et al.60 https://www2.mrc-lmb.cam.ac.uk/download/gctf/ MotionCor2 Zheng et al.58 https://emcore.ucsf.edu/ucsf-software AreTomo Zheng et al.59 https://msg.ucsf.edu/software

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Article Title: A robust method for on-chip production and manipulation of lipid vesicles by inverted emulsion.
    Article Snippet: .. F250A + B Critical commercial assays NEBuilder HiFi DNA Assembly Kit NEB, USA E2621 QIAprep Spin Miniprep Kit QIAGEN, DE 27104 QIAGEN Plasmid Maxi Kit QIAGEN, DE 12162 QIAquick PCR Purification Kit QIAGEN, DE 28104 myTXTL Sigma 70 Master Mix Kit Daicel Arbor Biosciences, USA 507024 Deposited data Confocal and Electron microscopy data Mendeley data https://doi.org/10.17632/rx7bkm4mtb.1 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Recombinant DNA pEXP5-NT/pT7 LuxR Gonzales et al. (2023) 29 N/A pEXP5-NT/pLux EGFP Gonzales et al. (2023) 29 N/A e2 Cell Reports Methods 6, 101326, March 23, 2026 OPEN ACCESS • 2xYTP Media: 1 L of a solution containing 5 g NaCl, 10 g yeast extract, 16 g tryptone, 40 mL of 1 M potassium phosphate dibasic solution, and 22 mL of 1 M potassium phosphate monobasic solution. ..

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-Lgi1/EPT antibody Abcam Cat# ab30868; RRID: AB_776017 Mouse anti-GRIA1 antibody UC Davis/NIH NeuroMab Facility Cat# 75-327; RRID: AB_2877405 Goat Anti-Rabbit IgG (H + L)-HRP Conjugate BioRad Cat# 1706515; RRID: AB_11125142 Goat Anti-Mouse IgG (H + L)-HRP Conjugate BioRad Cat# 1706516; RRID: AB_11125547 V5 Tag Monoclonal Antibody Invitrogen Cat# R960-25; RRID: AB_2556564 Beta Actin Polyclonal Antibody Thermo Fisher Scientific Cat# PA5-85271; RRID: AB_2792414 Bacterial and virus strains FSW-HRP-V5-LRRTM1 PF iVector-ICM Addgene #82536 FSW-HRP-V5-LRRTM2 PF iVector-ICM Addgene #82537 Biological samples Human LGI1 antibodies Jena University Hospital licence # 2019-1415 -Material Chemicals, peptides, and recombinant proteins Bafilomycin A1 Cayman Chemical Company Item #11038 EGTA-AM Thermo Fisher Scientific E1219 Tetrodotoxin citrate (TTX) Tocris Cat #1069 Biotin-XX Tyramide Reagent (BxxP) ApexBio Technology Cat #A8012 Tetanus toxin from Clostridium tetani Sigma T3194 Recombinant Enhanced GFP protein (His tag) Abcam ab134853 Papain Worthington Biochemical LK003178 DNase I Roche 10104159001 Poly-D-lysine Sigma P2636 MEM, no glutamine, no phenol red Thermo Fisher Scientific 51200038 N21-MAX Media Supplement (50X) Bio-Techne AR008 Transferrin Sigma 616420 Glutamax Thermo Fisher Scientific 35050038 Insulin Sigma I6634 Cytosine b-d-arabinofuranoside Sigma C1768 NeurobasalTM Medium Thermo Fisher Scientific 21103049 BrainPhysTM Neuronal Medium and SM1 Kit STEMCELL Technologies 05792 50-fluoro-20-deoxyuridine (FUDR) Fisher Scientific 10144760 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) Tocris 1045 D-( )-2-Amino-5-phosphonopentanoic acid (AP5) Tocris 0106 MES (2-(N-morpholino)ethanesulfonic acid) Sigma M3671 ProLongTM Glass Antifade Mountant Thermo Fisher Scientific P36982 LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific 11668019 Chloroquine diphosphate salt, 98% Thermo Fisher Scientific 455245000 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific 88817 Biotin Sigma B4501 DL-Dithiothreitol (DTT) Sigma D9779 ClarityTM Western ECL Substrate BioRad 1705060 Clarity Max Western ECL Substrate BioRad 1705062 (Continued on next page) 20 Cell Reports 43, 114186, May 28, 2024 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Q5 Site-Directed Mutagenesis Kit New England Biolabs E0552 PierceTM High Sensitivity Streptavidin-HRP Thermo Fisher Scientific 21130 NEBuilder HiFi DNA Gibson Assembly Master Mix New England Biolabs E2621 p24 ZeptoMetrix Kit Sigma 0801111 Experimental models: Cell lines HEK293T cells ATCC CRL-11268 Experimental models: Organisms/strains Sprague-Dawley Rat Charles River Strain: Crl:CD(SD) Oligonucleotides See Table S2 for oligonucleotides used for site-directed mutagenesis This paper N/A Recombinant DNA CamKII-LGI1-pHluorin This paper Addgene Plasmid #185537 CamKII-LGI1-S473L-pHluorin This paper Addgene Plasmid #185540 CamKII-LGI1-Y433A-pHluorin This paper Addgene Plasmid #185541 CamKII-LGI1-R474Q-pHluorin This paper Addgene Plasmid #185542 CamKII-LGI1-T380A-pHluorin This paper Addgene Plasmid #185543 CamKII-LGI1-E383A-pHluorin This paper Addgene Plasmid #185544 CamKII-LGI1-C200R-pHluorin This paper Addgene Plasmid #185545 CamKII-LGI1 (no tags) This paper N/A vGlut-pH Gift from Timothy A. Ryan34 N/A vGlut-mOrange-2 Hoppa et al., 201280 N/A iGluSnFR3 Aggarwal et al.58 Addgene Plasmid #178330 CMV-mRuby-synapsin Gift from Timothy A. Ryan Addgene Plasmid #187896 pKanCMV-mRuby3-18aa-actin Bajar et al.86 Addgene plasmid #74255 pLKO-synapsin-BFP Gift from Timothy A. Ryan Addgene Plasmid #191567 pLKO-empty-mTagBFP Gift from Timothy A. Ryan Addgene Plasmid #191566 CamKII-ADAM23-pHluorin This paper Addgene Plasmid #185539 pGP-AAV-syn-jGCaMP8f-WPRE Zhang et al.55 Addgene Plasmid #162376 CamKII-LGI1-pHmScarlet This paper Addgene Plasmid #185538 CamKII-LGI1-R474Q-pHmScarlet This paper N/A CamKII-LGI1-T380A-pHmScarlet This paper N/A CamKII-LGI1-E383A-pHmScarlet This paper N/A pCAGGS-SNAP25DC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-SNAP29DC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-Stx1ADC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-Stx4DC-IRES-mCherry Ibata et al., 201943 N/A CMV-IgK-pHluorin-TM-mRuby This paper Addgene Plasmid #185546 ER-pHluorin de Juan-Sanz et al., 201736 N/A FSW-HRP-V5-LRRTM2 Loh et al.52 Addgene Plasmid #82537 FSW-HRP-V5-LRRTM1 Loh et al.52 Addgene Plasmid #82536 pAAV-CaMKII-Archon1-EGFP Piatkevich et al.60 Addgene Plasmid #108417 hSyn-NPY-pHluorin Gift from Ruud F Toonen Persoon et al. 87 N/A VAMP2-pHmScarlet Gift from Pingyong Xu Liu et al.54 Addgene plasmid #166890 CMV-mRuby-synapsin Gift from Timothy A. Ryan Addgene Plasmid #187896 pLKO-synapsin-BFP Gift from Timothy A. Ryan Addgene Plasmid #191567 pLKO-empty-mTagBFP Gift from Timothy A. Ryan Addgene Plasmid #191566 (Continued on next page) Cell Reports 43, 114186, May 28, 2024 21 Article ll OPEN ACCESS .. Plasmids generated in this study are available at Addgene.org, as indicated in the key resources table.

    Construct:

    Article Title: Structural characterization of Thogoto Virus nucleoprotein provides insights into viral RNA encapsidation and RNP assembly.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Flag-tag Sigma MAB3118; RRID: AB_9470 Anti-HA-tag Sigma H3663; RRID: AB_262051 Anti-b-actin Sigma A2228; RRID: AB_476697 Anti-Flag-M2 affinity gel Sigma A2220; RRID: AB_10063035 Anti-THOV NP Ab Kochs et al.67 N/A Bacterial and virus strains E. coli BL21 (DE3) Rosetta strain Novagen/Sigma #70954 THOV, strain SiAr126 Albanese et al.64 N/A Chemicals, peptides, and recombinant proteins GST-tagged PreScission Protease This Paper N/A Seleno-L-methionine Sigma # S3132 Isopropyl-b-D-thiogalactopyranoside (IPTG) Sigma 10724815001 NP-40 alternative CalBioChem 492016 Triton X-100 Sigma 93426 Lysolecithin Sigma L5254 Deposited data THOV NP (delta 188-196) Apo Structure This Paper PDB: 8CJW THOV RNP This Paper PDB: 8RYT,EMDB: EMD-19599 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides single-stranded RNA of varying length (pU14 - pU24) This Paper https://www.idtdna.com/pages/products/ custom-dna-rna/custom-rna-oligos Primer used in this study (Table S5) This Paper N/A Recombinant DNA pET28 plasmids (THOV NP constructs) This Paper N/A pCAGGS Niwa et al.65 N/A pHH21-vNP-FFLuc Patzina et al.66 N/A pRL-SV40 Promega E2231 Software and algorithms Sedfit Schuck et al.46 https://sedfitsedphat.github.io/ SEDNTERP Laue et al.47 http://www.jphilo.mailway.com/sednterp.htm Omnisec No reference available https://www.malvernpanalytical.com/en/products/ product-range/omnisec SHELXD Sheldrick et al.48 https://www.ccp4.ac.uk/download/shelx.php HKL2MAP Pape et al.49 https://www.ccp4.ac.uk/schools/APS-2010/tutorials/ shelx/tutorial_shelx_chicago2008.pdf Coot Emsley et al.50 https://www.ccp4.ac.uk/download/#os=windows Phaser McCoy et al.51 https://www.ccp4.ac.uk/html/phaser.html Phenix Afonine et al.52 https://phenix-online.org/ PyMOL Molecular Graphics System, Version 2.5.2 Schrödinger https://pymol.org/ Consurf Server Ashkenazy et al.53 https://consurf.tau.ac.il/consurf_index.php Chimera Pettersen et al.54 https://www.cgl.ucsf.edu/chimera/ (Continued on next page) Structure 32, 1068–1078.e1–e5, August 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Relion 4 Kimanius et al.62 Zivanov et al.63 https://relion.readthedocs.io/en/release-4.0/ IMOD Mastronarde et al.55 https://bio3d.colorado.edu/imod/ Dynamo Castaño-Dı́ez et al.61 https://www.dynamo-em.org//w/ index.php?title=Main_Page Origin Pro https://www.originlab.com/ https://www.originlab.com/ GraphPad Prism 6 Dotmatics https://www.graphpad.com/support/updates/ ?program=Prism&platform=Win&version=6.04 TomoBEAR Balyschew et al.57 https://github.com/KudryashevLab/TomoBEAR GCTF Zhang et al.60 https://www2.mrc-lmb.cam.ac.uk/download/gctf/ MotionCor2 Zheng et al.58 https://emcore.ucsf.edu/ucsf-software AreTomo Zheng et al.59 https://msg.ucsf.edu/software

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    Software:

    Article Title: Structural characterization of Thogoto Virus nucleoprotein provides insights into viral RNA encapsidation and RNP assembly.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Flag-tag Sigma MAB3118; RRID: AB_9470 Anti-HA-tag Sigma H3663; RRID: AB_262051 Anti-b-actin Sigma A2228; RRID: AB_476697 Anti-Flag-M2 affinity gel Sigma A2220; RRID: AB_10063035 Anti-THOV NP Ab Kochs et al.67 N/A Bacterial and virus strains E. coli BL21 (DE3) Rosetta strain Novagen/Sigma #70954 THOV, strain SiAr126 Albanese et al.64 N/A Chemicals, peptides, and recombinant proteins GST-tagged PreScission Protease This Paper N/A Seleno-L-methionine Sigma # S3132 Isopropyl-b-D-thiogalactopyranoside (IPTG) Sigma 10724815001 NP-40 alternative CalBioChem 492016 Triton X-100 Sigma 93426 Lysolecithin Sigma L5254 Deposited data THOV NP (delta 188-196) Apo Structure This Paper PDB: 8CJW THOV RNP This Paper PDB: 8RYT,EMDB: EMD-19599 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides single-stranded RNA of varying length (pU14 - pU24) This Paper https://www.idtdna.com/pages/products/ custom-dna-rna/custom-rna-oligos Primer used in this study (Table S5) This Paper N/A Recombinant DNA pET28 plasmids (THOV NP constructs) This Paper N/A pCAGGS Niwa et al.65 N/A pHH21-vNP-FFLuc Patzina et al.66 N/A pRL-SV40 Promega E2231 Software and algorithms Sedfit Schuck et al.46 https://sedfitsedphat.github.io/ SEDNTERP Laue et al.47 http://www.jphilo.mailway.com/sednterp.htm Omnisec No reference available https://www.malvernpanalytical.com/en/products/ product-range/omnisec SHELXD Sheldrick et al.48 https://www.ccp4.ac.uk/download/shelx.php HKL2MAP Pape et al.49 https://www.ccp4.ac.uk/schools/APS-2010/tutorials/ shelx/tutorial_shelx_chicago2008.pdf Coot Emsley et al.50 https://www.ccp4.ac.uk/download/#os=windows Phaser McCoy et al.51 https://www.ccp4.ac.uk/html/phaser.html Phenix Afonine et al.52 https://phenix-online.org/ PyMOL Molecular Graphics System, Version 2.5.2 Schrödinger https://pymol.org/ Consurf Server Ashkenazy et al.53 https://consurf.tau.ac.il/consurf_index.php Chimera Pettersen et al.54 https://www.cgl.ucsf.edu/chimera/ (Continued on next page) Structure 32, 1068–1078.e1–e5, August 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Relion 4 Kimanius et al.62 Zivanov et al.63 https://relion.readthedocs.io/en/release-4.0/ IMOD Mastronarde et al.55 https://bio3d.colorado.edu/imod/ Dynamo Castaño-Dı́ez et al.61 https://www.dynamo-em.org//w/ index.php?title=Main_Page Origin Pro https://www.originlab.com/ https://www.originlab.com/ GraphPad Prism 6 Dotmatics https://www.graphpad.com/support/updates/ ?program=Prism&platform=Win&version=6.04 TomoBEAR Balyschew et al.57 https://github.com/KudryashevLab/TomoBEAR GCTF Zhang et al.60 https://www2.mrc-lmb.cam.ac.uk/download/gctf/ MotionCor2 Zheng et al.58 https://emcore.ucsf.edu/ucsf-software AreTomo Zheng et al.59 https://msg.ucsf.edu/software

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    other:

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CamKII vector Gift from Edward Boyden Chow et al. 88 Addgene Plasmid #22217 Vesicular stomatitis virus G glycoprotein Gift from Irving WeissmanHaselmann et al. 89 Addgene Plasmid #14888 Software and algorithms ImageJ NIH Schneider et al. 90 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ scientific-software/prism/ R R-project https://www.r-project.org RStudio RStudio https://www.rstudio.com Biorender Biorender https://www.biorender.com/ Other ChemiDocTM Touch Imaging System BioRad 1708374 Custom-built laser illuminated epifluorescence Microscope Axio Observer 3 ZEISS N/A iXon Ultra camera Andor - Oxford Instruments #DU-897U-CSO-#BV OasisTM UC160 Cooling System Solid State Cooling Systems UC160 Imaging chamber Warner Instruments RC-21BRFS Feedback loop temperature controller Warner Instruments TC-344C

    Isolation:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Membrane:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Protein Extraction:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Knock-Out:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Mutagenesis:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 2021 53 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc) 2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl 2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al. 40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 202153 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc)2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al.40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-Lgi1/EPT antibody Abcam Cat# ab30868; RRID: AB_776017 Mouse anti-GRIA1 antibody UC Davis/NIH NeuroMab Facility Cat# 75-327; RRID: AB_2877405 Goat Anti-Rabbit IgG (H + L)-HRP Conjugate BioRad Cat# 1706515; RRID: AB_11125142 Goat Anti-Mouse IgG (H + L)-HRP Conjugate BioRad Cat# 1706516; RRID: AB_11125547 V5 Tag Monoclonal Antibody Invitrogen Cat# R960-25; RRID: AB_2556564 Beta Actin Polyclonal Antibody Thermo Fisher Scientific Cat# PA5-85271; RRID: AB_2792414 Bacterial and virus strains FSW-HRP-V5-LRRTM1 PF iVector-ICM Addgene #82536 FSW-HRP-V5-LRRTM2 PF iVector-ICM Addgene #82537 Biological samples Human LGI1 antibodies Jena University Hospital licence # 2019-1415 -Material Chemicals, peptides, and recombinant proteins Bafilomycin A1 Cayman Chemical Company Item #11038 EGTA-AM Thermo Fisher Scientific E1219 Tetrodotoxin citrate (TTX) Tocris Cat #1069 Biotin-XX Tyramide Reagent (BxxP) ApexBio Technology Cat #A8012 Tetanus toxin from Clostridium tetani Sigma T3194 Recombinant Enhanced GFP protein (His tag) Abcam ab134853 Papain Worthington Biochemical LK003178 DNase I Roche 10104159001 Poly-D-lysine Sigma P2636 MEM, no glutamine, no phenol red Thermo Fisher Scientific 51200038 N21-MAX Media Supplement (50X) Bio-Techne AR008 Transferrin Sigma 616420 Glutamax Thermo Fisher Scientific 35050038 Insulin Sigma I6634 Cytosine b-d-arabinofuranoside Sigma C1768 NeurobasalTM Medium Thermo Fisher Scientific 21103049 BrainPhysTM Neuronal Medium and SM1 Kit STEMCELL Technologies 05792 50-fluoro-20-deoxyuridine (FUDR) Fisher Scientific 10144760 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) Tocris 1045 D-( )-2-Amino-5-phosphonopentanoic acid (AP5) Tocris 0106 MES (2-(N-morpholino)ethanesulfonic acid) Sigma M3671 ProLongTM Glass Antifade Mountant Thermo Fisher Scientific P36982 LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific 11668019 Chloroquine diphosphate salt, 98% Thermo Fisher Scientific 455245000 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific 88817 Biotin Sigma B4501 DL-Dithiothreitol (DTT) Sigma D9779 ClarityTM Western ECL Substrate BioRad 1705060 Clarity Max Western ECL Substrate BioRad 1705062 (Continued on next page) 20 Cell Reports 43, 114186, May 28, 2024 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Q5 Site-Directed Mutagenesis Kit New England Biolabs E0552 PierceTM High Sensitivity Streptavidin-HRP Thermo Fisher Scientific 21130 NEBuilder HiFi DNA Gibson Assembly Master Mix New England Biolabs E2621 p24 ZeptoMetrix Kit Sigma 0801111 Experimental models: Cell lines HEK293T cells ATCC CRL-11268 Experimental models: Organisms/strains Sprague-Dawley Rat Charles River Strain: Crl:CD(SD) Oligonucleotides See Table S2 for oligonucleotides used for site-directed mutagenesis This paper N/A Recombinant DNA CamKII-LGI1-pHluorin This paper Addgene Plasmid #185537 CamKII-LGI1-S473L-pHluorin This paper Addgene Plasmid #185540 CamKII-LGI1-Y433A-pHluorin This paper Addgene Plasmid #185541 CamKII-LGI1-R474Q-pHluorin This paper Addgene Plasmid #185542 CamKII-LGI1-T380A-pHluorin This paper Addgene Plasmid #185543 CamKII-LGI1-E383A-pHluorin This paper Addgene Plasmid #185544 CamKII-LGI1-C200R-pHluorin This paper Addgene Plasmid #185545 CamKII-LGI1 (no tags) This paper N/A vGlut-pH Gift from Timothy A. Ryan34 N/A vGlut-mOrange-2 Hoppa et al., 201280 N/A iGluSnFR3 Aggarwal et al.58 Addgene Plasmid #178330 CMV-mRuby-synapsin Gift from Timothy A. Ryan Addgene Plasmid #187896 pKanCMV-mRuby3-18aa-actin Bajar et al.86 Addgene plasmid #74255 pLKO-synapsin-BFP Gift from Timothy A. Ryan Addgene Plasmid #191567 pLKO-empty-mTagBFP Gift from Timothy A. Ryan Addgene Plasmid #191566 CamKII-ADAM23-pHluorin This paper Addgene Plasmid #185539 pGP-AAV-syn-jGCaMP8f-WPRE Zhang et al.55 Addgene Plasmid #162376 CamKII-LGI1-pHmScarlet This paper Addgene Plasmid #185538 CamKII-LGI1-R474Q-pHmScarlet This paper N/A CamKII-LGI1-T380A-pHmScarlet This paper N/A CamKII-LGI1-E383A-pHmScarlet This paper N/A pCAGGS-SNAP25DC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-SNAP29DC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-Stx1ADC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-Stx4DC-IRES-mCherry Ibata et al., 201943 N/A CMV-IgK-pHluorin-TM-mRuby This paper Addgene Plasmid #185546 ER-pHluorin de Juan-Sanz et al., 201736 N/A FSW-HRP-V5-LRRTM2 Loh et al.52 Addgene Plasmid #82537 FSW-HRP-V5-LRRTM1 Loh et al.52 Addgene Plasmid #82536 pAAV-CaMKII-Archon1-EGFP Piatkevich et al.60 Addgene Plasmid #108417 hSyn-NPY-pHluorin Gift from Ruud F Toonen Persoon et al. 87 N/A VAMP2-pHmScarlet Gift from Pingyong Xu Liu et al.54 Addgene plasmid #166890 CMV-mRuby-synapsin Gift from Timothy A. Ryan Addgene Plasmid #187896 pLKO-synapsin-BFP Gift from Timothy A. Ryan Addgene Plasmid #191567 pLKO-empty-mTagBFP Gift from Timothy A. Ryan Addgene Plasmid #191566 (Continued on next page) Cell Reports 43, 114186, May 28, 2024 21 Article ll OPEN ACCESS .. Plasmids generated in this study are available at Addgene.org, as indicated in the key resources table.

    Subcloning:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Plasmid Preparation:

    Article Title: TRPM2 enhances ischemic excitotoxicity by associating with PKCγ.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TRPM2 Novus NB110-81601; RRID: AB_1147355 GluN2A Cell Signaling Technology 4205S; RRID: AB_2112295 GluN2B Cell Signaling Technology 4207S; RRID: AB_1264223 PKC-g Cell Signaling Technology 59090S; RRID: AB_2799557 Pan-cadherin Cell Signaling Technology 4068S; RRID: AB_2158565 GAPDH Cell Signaling Technology 5174S; RRID: AB_10622025 GST-Tag Cell Signaling Technology 2622S; RRID: AB_331670 His-Tag Cell Signaling Technology 12698S; RRID: AB_2744546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology 7076; RRID: AB_330924 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology 7074; RRID: AB_2099233 Bacterial and virus strains Escherichia coli BL21(DE3) cells NEB (New England Biolabs) C2527 Chemicals, peptides, and recombinant proteins Tetrazolium chloride Sigma-Aldrich T-8877 NMDA Tocris 0114 AP5 Cayman Chemical 14539 MK-801 Sigma-Aldrich M107 PMA Sigma-Aldrich 524400 H2O2 Thermal Fisher Scientific 200745 EGTA Cayman Chemical 11706 BAPTA-AM Cayman Chemical 15551 NP40 Thermal Fisher Scientific 28324 TritonTM X-100 Thermal Fisher Scientific T-9284 Bovine Serum Albumin Sigma-Aldrich 9048-46-8 isopropyl-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich I5502-10G Neurobasal Medium Thermal Fisher Scientific 21103–049 PluronicTM F-127 Thermal Fisher Scientific P3000MP Fura2-AM Thermal Fisher Scientific F1221 DAF-FM Thermal Fisher Scientific D23844 MitoSOX-Red Thermal Fisher Scientific M36008 Rhodamine-123 Thermal Fisher Scientific R302 Proteinase inhibitors Sigma-Aldrich 539131-10VL Phosphatase inhibitors Thermal Fisher Scientific 78428 Protein A/G PLUS-Agarose Santa Cruz Biotechnology sc-2003 2x Laemmli Sample Buffer BIO-RAD 1610737 TAT-SC (sequence: YGRKKRRQRRR VILLKDHTLEYPVF) GenScript Biotech N/A TAT-M2PBM (sequence: YGRKKRRQRRR WGLDVPNLLISVTGGA) GenScript Biotech N/A DpnI BioLabs R0176L Critical commercial assays PKCg Kinase Enzyme System Promega V3391 PfuUltra HF Agilent 600380–51 PierceTM Rapid Gold BCA Protein Assay Kit Thermal Fisher Scientific A53225 (Continued on next page) 16 Cell Reports 43, 113722, February 27, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Cell Surface Protein Isolation Kit Thermal Fisher Scientific 89881 ProteoExtractTM Native Membrane Protein Extraction Kit Calbiochem 444810 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Experimental models: Organisms/strains C57BJ6 mice JAX 000664 Global TRPM2 knockout mice Yasuo Mori’s lab at Kyoto University N/A Oligonucleotides Primers for mutagenesis and subcloning; see Table S1 This study N/A Recombinant DNA GluN1A Luo et al.40 Addgene, 17928 GluN2A Luo et al.40 Addgene, 17924 GluN2B Luo et al.40 Addgene, 17925 PKC-g Oancea et al.41 Addgene, 112266 PKC-g-DN Soh et al.42 Addgene, 21239 CKAR Violin et al.17 Addgene, 14860 pET15b vector containing a removable TEV protease recognition site Zong et al.6 MilliporeSigma 69661–3 pGEX-4T3 vector containing a removable tobacco etch virus (TEV) protease recognition site Zong et al.6 NovoPro V010916 pcDNA4/TO-FLAG-hTRPM2 Sharenberg AM at University of Washington N/A Software and algorithms Prism 9 Graphpad https://www.graphpad.com/ Photoshop 2020 Adobe https://www.adobe.com/ Illustrator 2020 Adobe https://www.adobe.com/ NIS-Elements Nikon N/A ImageJ Schneider et al.43 https://imagej.net/ij/ Other Rotarod Maze https://maze.conductscience.com Avestin EmulsiFlex C3 ATA Scientific Instruments https://www.atascientific.com.au/ products/avestin-emulsiflex-c3 Glutathione Sepharose 4B column GE Healthcare Discontinued Ni2+-nitrilotriacetic acid (NTA) column GE Healthcare Discontinued Amicon stirred ultrafiltration cell unit EMD Millipore UFSC40001 CoolSNAP HQ2 Teledyne Photometrics https://www.photometrics.com Ultrasonic cleaner Thermal Fisher Scientific CPX952136R Axopatch 200B amplifier Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system/ amplifiers ..

    Article Title: A robust method for on-chip production and manipulation of lipid vesicles by inverted emulsion.
    Article Snippet: .. F250A + B Critical commercial assays NEBuilder HiFi DNA Assembly Kit NEB, USA E2621 QIAprep Spin Miniprep Kit QIAGEN, DE 27104 QIAGEN Plasmid Maxi Kit QIAGEN, DE 12162 QIAquick PCR Purification Kit QIAGEN, DE 28104 myTXTL Sigma 70 Master Mix Kit Daicel Arbor Biosciences, USA 507024 Deposited data Confocal and Electron microscopy data Mendeley data https://doi.org/10.17632/rx7bkm4mtb.1 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Recombinant DNA pEXP5-NT/pT7 LuxR Gonzales et al. (2023) 29 N/A pEXP5-NT/pLux EGFP Gonzales et al. (2023) 29 N/A e2 Cell Reports Methods 6, 101326, March 23, 2026 OPEN ACCESS • 2xYTP Media: 1 L of a solution containing 5 g NaCl, 10 g yeast extract, 16 g tryptone, 40 mL of 1 M potassium phosphate dibasic solution, and 22 mL of 1 M potassium phosphate monobasic solution. ..

    Article Title: Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-Lgi1/EPT antibody Abcam Cat# ab30868; RRID: AB_776017 Mouse anti-GRIA1 antibody UC Davis/NIH NeuroMab Facility Cat# 75-327; RRID: AB_2877405 Goat Anti-Rabbit IgG (H + L)-HRP Conjugate BioRad Cat# 1706515; RRID: AB_11125142 Goat Anti-Mouse IgG (H + L)-HRP Conjugate BioRad Cat# 1706516; RRID: AB_11125547 V5 Tag Monoclonal Antibody Invitrogen Cat# R960-25; RRID: AB_2556564 Beta Actin Polyclonal Antibody Thermo Fisher Scientific Cat# PA5-85271; RRID: AB_2792414 Bacterial and virus strains FSW-HRP-V5-LRRTM1 PF iVector-ICM Addgene #82536 FSW-HRP-V5-LRRTM2 PF iVector-ICM Addgene #82537 Biological samples Human LGI1 antibodies Jena University Hospital licence # 2019-1415 -Material Chemicals, peptides, and recombinant proteins Bafilomycin A1 Cayman Chemical Company Item #11038 EGTA-AM Thermo Fisher Scientific E1219 Tetrodotoxin citrate (TTX) Tocris Cat #1069 Biotin-XX Tyramide Reagent (BxxP) ApexBio Technology Cat #A8012 Tetanus toxin from Clostridium tetani Sigma T3194 Recombinant Enhanced GFP protein (His tag) Abcam ab134853 Papain Worthington Biochemical LK003178 DNase I Roche 10104159001 Poly-D-lysine Sigma P2636 MEM, no glutamine, no phenol red Thermo Fisher Scientific 51200038 N21-MAX Media Supplement (50X) Bio-Techne AR008 Transferrin Sigma 616420 Glutamax Thermo Fisher Scientific 35050038 Insulin Sigma I6634 Cytosine b-d-arabinofuranoside Sigma C1768 NeurobasalTM Medium Thermo Fisher Scientific 21103049 BrainPhysTM Neuronal Medium and SM1 Kit STEMCELL Technologies 05792 50-fluoro-20-deoxyuridine (FUDR) Fisher Scientific 10144760 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) Tocris 1045 D-( )-2-Amino-5-phosphonopentanoic acid (AP5) Tocris 0106 MES (2-(N-morpholino)ethanesulfonic acid) Sigma M3671 ProLongTM Glass Antifade Mountant Thermo Fisher Scientific P36982 LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific 11668019 Chloroquine diphosphate salt, 98% Thermo Fisher Scientific 455245000 PierceTM Streptavidin Magnetic Beads Thermo Fisher Scientific 88817 Biotin Sigma B4501 DL-Dithiothreitol (DTT) Sigma D9779 ClarityTM Western ECL Substrate BioRad 1705060 Clarity Max Western ECL Substrate BioRad 1705062 (Continued on next page) 20 Cell Reports 43, 114186, May 28, 2024 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Q5 Site-Directed Mutagenesis Kit New England Biolabs E0552 PierceTM High Sensitivity Streptavidin-HRP Thermo Fisher Scientific 21130 NEBuilder HiFi DNA Gibson Assembly Master Mix New England Biolabs E2621 p24 ZeptoMetrix Kit Sigma 0801111 Experimental models: Cell lines HEK293T cells ATCC CRL-11268 Experimental models: Organisms/strains Sprague-Dawley Rat Charles River Strain: Crl:CD(SD) Oligonucleotides See Table S2 for oligonucleotides used for site-directed mutagenesis This paper N/A Recombinant DNA CamKII-LGI1-pHluorin This paper Addgene Plasmid #185537 CamKII-LGI1-S473L-pHluorin This paper Addgene Plasmid #185540 CamKII-LGI1-Y433A-pHluorin This paper Addgene Plasmid #185541 CamKII-LGI1-R474Q-pHluorin This paper Addgene Plasmid #185542 CamKII-LGI1-T380A-pHluorin This paper Addgene Plasmid #185543 CamKII-LGI1-E383A-pHluorin This paper Addgene Plasmid #185544 CamKII-LGI1-C200R-pHluorin This paper Addgene Plasmid #185545 CamKII-LGI1 (no tags) This paper N/A vGlut-pH Gift from Timothy A. Ryan34 N/A vGlut-mOrange-2 Hoppa et al., 201280 N/A iGluSnFR3 Aggarwal et al.58 Addgene Plasmid #178330 CMV-mRuby-synapsin Gift from Timothy A. Ryan Addgene Plasmid #187896 pKanCMV-mRuby3-18aa-actin Bajar et al.86 Addgene plasmid #74255 pLKO-synapsin-BFP Gift from Timothy A. Ryan Addgene Plasmid #191567 pLKO-empty-mTagBFP Gift from Timothy A. Ryan Addgene Plasmid #191566 CamKII-ADAM23-pHluorin This paper Addgene Plasmid #185539 pGP-AAV-syn-jGCaMP8f-WPRE Zhang et al.55 Addgene Plasmid #162376 CamKII-LGI1-pHmScarlet This paper Addgene Plasmid #185538 CamKII-LGI1-R474Q-pHmScarlet This paper N/A CamKII-LGI1-T380A-pHmScarlet This paper N/A CamKII-LGI1-E383A-pHmScarlet This paper N/A pCAGGS-SNAP25DC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-SNAP29DC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-Stx1ADC-IRES-mCherry Ibata et al., 201943 N/A pCAGGS-Stx4DC-IRES-mCherry Ibata et al., 201943 N/A CMV-IgK-pHluorin-TM-mRuby This paper Addgene Plasmid #185546 ER-pHluorin de Juan-Sanz et al., 201736 N/A FSW-HRP-V5-LRRTM2 Loh et al.52 Addgene Plasmid #82537 FSW-HRP-V5-LRRTM1 Loh et al.52 Addgene Plasmid #82536 pAAV-CaMKII-Archon1-EGFP Piatkevich et al.60 Addgene Plasmid #108417 hSyn-NPY-pHluorin Gift from Ruud F Toonen Persoon et al. 87 N/A VAMP2-pHmScarlet Gift from Pingyong Xu Liu et al.54 Addgene plasmid #166890 CMV-mRuby-synapsin Gift from Timothy A. Ryan Addgene Plasmid #187896 pLKO-synapsin-BFP Gift from Timothy A. Ryan Addgene Plasmid #191567 pLKO-empty-mTagBFP Gift from Timothy A. Ryan Addgene Plasmid #191566 (Continued on next page) Cell Reports 43, 114186, May 28, 2024 21 Article ll OPEN ACCESS .. Plasmids generated in this study are available at Addgene.org, as indicated in the key resources table.

    Polymerase Chain Reaction:

    Article Title: A robust method for on-chip production and manipulation of lipid vesicles by inverted emulsion.
    Article Snippet: .. F250A + B Critical commercial assays NEBuilder HiFi DNA Assembly Kit NEB, USA E2621 QIAprep Spin Miniprep Kit QIAGEN, DE 27104 QIAGEN Plasmid Maxi Kit QIAGEN, DE 12162 QIAquick PCR Purification Kit QIAGEN, DE 28104 myTXTL Sigma 70 Master Mix Kit Daicel Arbor Biosciences, USA 507024 Deposited data Confocal and Electron microscopy data Mendeley data https://doi.org/10.17632/rx7bkm4mtb.1 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Recombinant DNA pEXP5-NT/pT7 LuxR Gonzales et al. (2023) 29 N/A pEXP5-NT/pLux EGFP Gonzales et al. (2023) 29 N/A e2 Cell Reports Methods 6, 101326, March 23, 2026 OPEN ACCESS • 2xYTP Media: 1 L of a solution containing 5 g NaCl, 10 g yeast extract, 16 g tryptone, 40 mL of 1 M potassium phosphate dibasic solution, and 22 mL of 1 M potassium phosphate monobasic solution. ..

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 2021 53 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc) 2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl 2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al. 40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 202153 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc)2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al.40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Purification:

    Article Title: A robust method for on-chip production and manipulation of lipid vesicles by inverted emulsion.
    Article Snippet: .. F250A + B Critical commercial assays NEBuilder HiFi DNA Assembly Kit NEB, USA E2621 QIAprep Spin Miniprep Kit QIAGEN, DE 27104 QIAGEN Plasmid Maxi Kit QIAGEN, DE 12162 QIAquick PCR Purification Kit QIAGEN, DE 28104 myTXTL Sigma 70 Master Mix Kit Daicel Arbor Biosciences, USA 507024 Deposited data Confocal and Electron microscopy data Mendeley data https://doi.org/10.17632/rx7bkm4mtb.1 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Recombinant DNA pEXP5-NT/pT7 LuxR Gonzales et al. (2023) 29 N/A pEXP5-NT/pLux EGFP Gonzales et al. (2023) 29 N/A e2 Cell Reports Methods 6, 101326, March 23, 2026 OPEN ACCESS • 2xYTP Media: 1 L of a solution containing 5 g NaCl, 10 g yeast extract, 16 g tryptone, 40 mL of 1 M potassium phosphate dibasic solution, and 22 mL of 1 M potassium phosphate monobasic solution. ..

    Electron Microscopy:

    Article Title: A robust method for on-chip production and manipulation of lipid vesicles by inverted emulsion.
    Article Snippet: .. F250A + B Critical commercial assays NEBuilder HiFi DNA Assembly Kit NEB, USA E2621 QIAprep Spin Miniprep Kit QIAGEN, DE 27104 QIAGEN Plasmid Maxi Kit QIAGEN, DE 12162 QIAquick PCR Purification Kit QIAGEN, DE 28104 myTXTL Sigma 70 Master Mix Kit Daicel Arbor Biosciences, USA 507024 Deposited data Confocal and Electron microscopy data Mendeley data https://doi.org/10.17632/rx7bkm4mtb.1 Experimental models: Cell lines HEK293T cells ATCC CRL-3216 Recombinant DNA pEXP5-NT/pT7 LuxR Gonzales et al. (2023) 29 N/A pEXP5-NT/pLux EGFP Gonzales et al. (2023) 29 N/A e2 Cell Reports Methods 6, 101326, March 23, 2026 OPEN ACCESS • 2xYTP Media: 1 L of a solution containing 5 g NaCl, 10 g yeast extract, 16 g tryptone, 40 mL of 1 M potassium phosphate dibasic solution, and 22 mL of 1 M potassium phosphate monobasic solution. ..

    Ligation:

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 2021 53 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc) 2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl 2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al. 40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 202153 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc)2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al.40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Reverse Transcription:

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 2021 53 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc) 2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl 2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al. 40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 202153 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc)2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al.40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Gene Expression:

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 2021 53 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc) 2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl 2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al. 40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 202153 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc)2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al.40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Sequencing:

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 2021 53 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc) 2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl 2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al. 40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Article Title: Systematic analysis of nonsense variants uncovers peptide release rate as a novel modifier of nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains EMBacY Geneva Biotech N/A MegaX DH10B T1R Electrocompetent Cells ThermoFisher Scientific C640003 E. coli BL21(DE3) Novagen, Sigma 69450 Chemicals, peptides, and recombinant proteins EcoRI NEB R3101S XhoI NEB R0146S MfeI NEB R3589S Q5 High-Fidelity DNA Polymerase NEB M0492S Exonuclease I NEB M0293S AmpureXP beads Beckman Coulter A63882 Carbenicillin RPI C46000–5.0 Luria Agar RPI L24020–500.0 DMSO Sigma-Aldrich D2650-100ML Puromycin VWR 97064–280 SMG1 inhibitor 11j MedChem Express HY-124719 TRIzol ThermoFisher Scientific 15596018 Actinomycin D Sigma-Aldrich A9415 Tris Helicon Sys-S0002–0.5 HCl SigmaTeс ООН 1789 KCl Panreac AppliChem 191494.1211 Triton X-100 MP Biomedicals 194854 Glycerol MP Biomedicals 193996 PMSF Serva 32395 DTT Diaem D3483123.0100 His-tagged Ulp1 protease Shuvalov et al., 202153 N/A Ni-NTA Agarose Cytiva 17531802 BSA ThermoFisher Scientific 23208 RRL Lysate Green Hectares N/A Micrococcal Nuclease Fermentas EN0181 EGTA Sigma-Aldrich 324626 HEPES Helicon Sys-Q0005–0.5 KOH Panreac AppliChem 121515.1211 KOAc Helicon Am-0698-0.5 Mg(OAc)2 MERCK 105819 ATP ThermoFisher Scientific R0441 GTP ThermoFisher Scientific R0461 Amino Acids Promega L4461 Spermidine Sigma-Aldrich 85558-5G Aminoacylated total rabbit tRNA gift from Vladimir I. Katunin N/A Creatine Phosphate Sigma-Aldrich 27920 Creatine Kinase Sigma-Aldrich C9858 Ribolock ThermoFisher Scientific EO0381 (Continued on next page) e1 Cell Genomics 5, 100882, July 9, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Sucrose Panreac AppliChem 141621.1211 MgCl2 Panreac AppliChem 141396.1211 Critical commercial assays Quick Ligation Kit NEB M2200L Klenow Fragment NEB M0212S NucleoSpin Gel and PCR Clean-up kit Macherey Nagel 740609.250 Gibson Assembly Master Mix NEB E2611L NucleoBond Xtra Midi EF kit Macherey Nagel 740420.50 Turbo DNA-free kit ThermoFisher Scientific AM1907 Superscript II Reverse Transcriptase ThermoFisher Scientific 18064014 Kapa HotStart PCR Kit Roche KAPA KK2502 Qiagen RNAeasy Plus Mini Kit Qiagen 74136 PrimeTime Gene Expression Master Mix Integrated DNA Technologies 1055772 SuperScript III First Strand Synthesis Kit ThermoFisher Scientific 1872852 QuikChange Site-Directed Mutagenesis Kit Agilent Technologies 200518–5 T7 RiboMAX TM Large Scale RNA Production System Promega P1320 NanoGlo Promega N113B Deposited data Sequencing data GEO GSE261151 Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID:CVCL_0063 HEK293T cells with Lox2272 and LoxP cassette Khandelia et al.40 Courtesy Taliaferro Lab MPRA Cell Lines This paper N/A Glycine/Tyrosie luminescent NMD reporter cell lines This paper N/A Oligonucleotides G_Top: AATTCAGAACCACCAGAACCA CCTTAGCCAGAACCACCAGAACCACCC Integrated DNA Technologies N/A Y_Top: AATTCAGAACCACCAGAACCA CCTTAGTAAGAACCACCAGAACCACCC Integrated DNA Technologies N/A G_Bottom: TCGAGGGTGGTTCTGGT GGTTCTGGCTAAGGTGGTTCTGGT GGTTCTG Integrated DNA Technologies N/A Y_Bottom: TCGAGGGTGGTTCTGG TGGTTCTTACTAAGGTGGTTCTGG TGGTTCTG Integrated DNA Technologies N/A Oligo library: CTA GCA AAC TGG GGC ACA GCC TCG AGG GTG GTT CTG GTG GTN NNN NNT RRN GTG GTT CTG GTG GTT CTG AAT TCG ACT ACA AGG ACC ACG ACG G Eurofins N/A Oligo reverse primer: CACCGTCGTGGTCCTTGTAGTC Integrated DNA Technologies N/A Reverse transcription primer: CCAGGATTCTCCTCGACGTC Integrated DNA Technologies N/A KAPA PCR Forward primer: ACACTCT TTCCCTACACGACGCTCTTCCGATC TGCAGACTTCCTCTGCCCTC Integrated DNA Technologies N/A (Continued on next page) Cell Genomics 5, 100882, July 9, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER KAPA PCR Reverse Primer: AGACGT GTGCTCTTCCGATCTNNNNNNNNtg gggcacagcctcga Integrated DNA Technologies N/A Illumina Indexes Illumina Custom Firefly Primer 1: GGA TCT ACT GGT CTG CCT AAA G Integrated DNA Technologies N/A Firefly Primer 2: CGC AGT ATC CGG AAT GAT TTG Integrated DNA Technologies N/A Firefly Probe:/5HEX/TGT CGC TCT/ZEN/ GCC TCA TAG AAC TGC/3IABkFQ/ Integrated DNA Technologies N/A Renilla Primer 1: CAT GGG ATG AAT GGC CTG ATA Integrated DNA Technologies N/A Renilla Primer 2: CAA CAT GGT TTC CAC GAA GAA G Integrated DNA Technologies N/A Renilla Probe:/56-FAM/TGC GTT GAT/ ZEN/CAA ATC TGA AGA AGG AGA/ 3IABkFQ/ Integrated DNA Technologies N/A RV3L: CTAGCAAAATAGGCTGTCCCCAG Evrogen N/A

    Control:

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    Transfection:

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    Protease Inhibitor:

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.

    Lysis:

    Article Title: Systematic identification and characterization of eukaryotic and viral 2A peptide-bond-skipping sequences.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-vinculin Cell Signaling 4650S; RRID: AB_10559207 Mouse monoclonal anti-NanoLuciferase R&D Systems MAB10026-100; RRID: AB_3657074 Rabbit anti-Fruit fly PABP Boster DZ41256 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich F1804; RRID: AB_262044 Anti-rabbit IgG, HRP-linked antibody Cell Signaling 7074S; RRID: AB_2099233 Anti-mouse IgG, HRP-linked antibody Cell Signaling 7076S; RRID: AB_330924 Normal Rabbit Control IgG SinoBiological CR1; RRID:AB_3073921 Bacterial and virus strains BL21(DE3) Competent cells Thermo Scientific EC0114 NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides, and recombinant proteins Lipofectamine 2000 Transfection Reagent Invitrogen 11668019 Effectene Reagent Qiagen 301425 NEBExpress® T4 Lysozyme NEB P8115L cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Roche 4693159001 TURBO DNaseTM (2 U/μL) Invitrogen AM2238 Critical commercial assays NEBExpress® E. coli Lysis Reagent New England Biolabs P8116L NEBExpress® Cell-free E. coli Protein Synthesis System New England Biolabs E5360L NuPAGETM MES SDS Running Buffer (20×) Invitrogen NP0002 NuPAGETM Transfer Buffer (20×) Invitrogen NP00061 Quick-Start Bradford 1× Dye Reagent Bio-Rad 5000202 EZview Red Protein G Affinity Gel beads Millipore E3403 S-TrapTM micro spin columns ProtiFi C02-micro-80 ReproSil 1.9 μm C18 beads, 120A resin Evosep Biosystems VAT: DK37510068 Deposited data Full analysis pipeline including pHMM models and search results for major sequence databases This paper https://github.com/rnabioco/ 2a-peptide-search Experimental models: Cell lines HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 S2 cells Gibco R69007 Recombinant DNA Full list of reporter constructs made and tested This paper; Table S3 N/A Software and algorithms HMMER software (version 3.4) Zhang and Wood39 N/A Skylign Wheeler et al.40 N/A InterProScan Jones et al.41 N/A ImageJ Schneider et al.42 https://imagej.net/ij/ 14 Cell Reports 44, 115822, July 22, 2025 .. HEK293T cells (ATCC) were grown in DMEM and 10% FBS (Gibco) at 37◦C with 5% CO2.



    Similar Products

    cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models  (ATCC)
    99
    ATCC cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models
    Cell Lines Hek293t Cells Atcc Crl3216 H Vegf Reporter 293 Cell Line Genomeditech Gm C09057 Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42285094-518-7-11
    Average 99 stars, based on 1 article reviews
    cell lines hek293t cells atcc crl3216 h vegf reporter 293 cell line genomeditech gm c09057 experimental models - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t atcc crl  (ATCC)
    99
    ATCC cell lines hek293t atcc crl
    Cell Lines Hek293t Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42263678-218-161-164
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t atcc crl 3216 oligonucleotides primer  (ATCC)
    99
    ATCC cell lines hek293t atcc crl 3216 oligonucleotides primer
    Cell Lines Hek293t Atcc Crl 3216 Oligonucleotides Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42268722-64-87-90
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl 3216 oligonucleotides primer - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t atcc crl 3216  (ATCC)
    99
    ATCC cell lines hek293t atcc crl 3216
    Cell Lines Hek293t Atcc Crl 3216, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42228573-267-142-145
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl 3216 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines homo sapiens hek293t atcc rrid cvcl 0063  (ATCC)
    99
    ATCC cell lines homo sapiens hek293t atcc rrid cvcl 0063
    Cell Lines Homo Sapiens Hek293t Atcc Rrid Cvcl 0063, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42213772-176-223-228
    Average 99 stars, based on 1 article reviews
    cell lines homo sapiens hek293t atcc rrid cvcl 0063 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t atcc  (ATCC)
    99
    ATCC cell lines hek293t atcc
    Cell Lines Hek293t Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T%2F17/pm42213790-303-257-260
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t atcc cat  (ATCC)
    99
    ATCC cell lines hek293t atcc cat
    Cell Lines Hek293t Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T%2F17/pm42172124-270-61-64
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t atcc crl 3216 oligonucleotides  (ATCC)
    99
    ATCC cell lines hek293t atcc crl 3216 oligonucleotides
    Cell Lines Hek293t Atcc Crl 3216 Oligonucleotides, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293T/pm42154591-165-7-10
    Average 99 stars, based on 1 article reviews
    cell lines hek293t atcc crl 3216 oligonucleotides - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hek293t cells atcc crl 1573 oligonucleotides sgrna  (ATCC)
    99
    ATCC cell lines hek293t cells atcc crl 1573 oligonucleotides sgrna
    Cell Lines Hek293t Cells Atcc Crl 1573 Oligonucleotides Sgrna, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+cells+atcc+crl/293/pm42096331-233-3-7
    Average 99 stars, based on 1 article reviews
    cell lines hek293t cells atcc crl 1573 oligonucleotides sgrna - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results